Jobs By Category:
PHP
Website Design
Graphic Design
Data Entry
MySQL
SEO
Copywriting
Flash
Javascript
Articles
HTML
Logo Design
Programming
Marketing
Link Building
Wordpress
CSS
Joomla
Data Processing
Internet Marketing
.NET
Photoshop
Script Installation
Web Promotion
Java
Social Networking
Article Rewriting
Facebook
XML
Blog


Thousands of experts bid on your personal project at ScriptLance.com

List of Biology projects available


Start saving/earning now with ScriptLance, Get A FreeLancer or EU Freelance. Below is some already posted projects with already placed bids:


Name/Technologies Bids Avg Details

picture book illustrator (13 days ago) 0 n/a View Bids
i am looking for someone who can illustrate a selection of my poems for a small fee.the first poem i would like illustrated can be viewed in the attachment.i imagine roughly one image per stanza; i would like to present the piece as a picture book.i am envisioning simple illustrations that create an innocent and naive feel or mood. Full details Place Bid

Biomechanics-12037 (13 days ago) 0 n/a View Bids
*************Deadline: 30 hours after confirmation**************The following assignment has been designed to augment information studied in Exercise and Sport Biomechanics. It is in question and answer form consisting 12 questions. Formulas and calculations required.Please use plagiarism free content and references should be accurate in Harvard style.All details are mentioned in attachment. Full details Place Bid

Genome assembly software (17 days ago) 0 n/a View Bids
I need a a software for genome assembly based on an algorithm of mine. In genome assembly the software is given millions of strings (reads) and merges two strings based on some detected overlap between them. For example:AAGTTAAATGAGA and GTTCCCAAGTTAA will merge into:GTTCCCAAGTTAAAAGTTAAATGAGA because AAGTTAA is a an overlapping string between them. So basically, for every set of strings with overlap between the you are looking for "the shortest common superstring" that both of the Full details Place Bid

Customer Distribution Rules (Webform+Jquery+Sql Server) (28 days ago) 0 n/a View Bids
I need some one capable to create a few forms using asp.net webforms with jquery and saving data on sql server. The goal of this jobs is create a distribution customer rule to asign every day a lote of customer to our agents. You must have excellent skills on Jquery because there are a few task to do with Jquery and we dont have time to waste while you learn how to do stuff. Is important you can provide tooltips help for each field in forms to guide user on what he has to do (see Full details Place Bid

OnLine Newspaper (28 days ago) 0 n/a View Bids
I Bought “Onliine Newspaper” through the Freemarket on Freelancer.com.I would like to use this as our on-line shop newspaper to communicate with our local customers.The product that I downloaded is the “Onliine Newspaper” (Please note the two i in the spelling) and to find it, once on the www.freelancer.com, use the search project, then type Onliine Newspaper, then use the arrow on the right and select “Search Freemarket”.You will arrive to the proper template for this product. You Full details Place Bid

CUDA Programmers needed (28 days ago) 0 n/a View Bids
I need CUDA programmers who can write a program for Multiple sequence alignment. Both the simple project only but code has to written with explanation and in a very simple way.Easily understandable. I have both the programs written in C but I need it in CUDA C or atleast in CUDA python. Time constraint is the main problem.Your help would be very much appreciated. Full details Place Bid

Full Analyze Report and Recommendations on Website SEO (29 days ago) 0 n/a View Bids
Full review about our website:- SEO analyze- HTML analyze - Webdesign analyzeI need full report on "PDF" or "Word" with recommendations. Full details Place Bid

Biochemical Engineering - Spatial Science - 11310 (29 days ago) 0 n/a View Bids
Introduction to Engineering and Spatial Science ApplicationsAll the details are in the attached file*********IMPORTANT*************The work must be plagiarism free*********IMPORTANT*************Need the completed work by 11 am on 24th April Full details Place Bid

Complete Site Migration Cs-Cart 2 Magento (34 days ago) 0 n/a View Bids
We are looking for someone to Migrate all content and data from our existing CS-Cart Store to Magento. This includes but not limited to:OrdersCustomersProductsPricingMeta DataImagesDesign and LookETC...Basically we need everything migrated.We will also need you to keep track of all the existing and new URLs and create 301 redirects for all of them.http://diploma-world.comhappy bidding Full details Place Bid

Simple Chemistry Questions needing solution (34 days ago) 0 n/a View Bids
I have some basic chemistry questions that requires solutions. The questions are attached. I have a minimum budget as the questions are quite easy. Full details Place Bid

Rental websites Creation fully Functional (41 days ago) 0 n/a View Bids
Rental websites Creation fully Functional base on instruction and according to client requirements .. Private project for farhan as logicscreators .as discussed .Thanks Full details Place Bid

PMS Interface creation (Urgent) (41 days ago) 0 n/a View Bids
I need someone to urgently create a nice interface for an opensource project management system. If you cannot deliver, dont waste my time and yours. This needs to be started right-away. If you cannot start now, dont bid. Full details Place Bid

we are looking for a 3d logo designer (41 days ago) 0 n/a View Bids
we are looking for a 3d logo designer Full details Place Bid

Local Medical Writing/knowlkedge (41 days ago) 0 n/a View Bids
Need a book on community medicine and forensic medicine in Sri Lanka.have to include all diseases and percentages in all the provinces Full details Place Bid

image work for PhotoshopXpert (45 days ago) 0 n/a View Bids
PhotoshopXpert private project Full details Place Bid

Article Writer Wanted ( Long Term ) (45 days ago) 0 n/a View Bids
In need of English Native writers who can provide - REQUIREMENTS- Copyscape passed.- No Grammar and Spelling mistakes.- Capable of writing content on various niches. ( As of now, with the Creditcard/Cashback Niche)-SEO optimized.-Unique and well researched articles.-Articles should be rich in content.-Capable of turning 5+ articles in 24 hours.-As we are talking about long term writing, regular communication needed.-Payment will be done after approving the article. Poor work with c Full details Place Bid

i need a biology tutor. (45 days ago) 0 n/a View Bids
i need a biology tutor who can handle courses for US student online courses and get good grades. Full details Place Bid

Math & Science Experts-Small project and quick money (56 days ago) 0 n/a View Bids
We are looking for someone who is expert in Math,Science or Engineering subjects.Who thinks that he can solve problems easily.If you have the above potential in you then first go through the content in the attached file and then bid.Willing to pay 30$ .Please pm me if you have any questions or queries. Full details Place Bid

Result pages:
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8





Our partners scimilar projects list for Biology or mistersoft.org projects related to Biology work